-
Statistical analysis br ACCEPTED MANUSCRIPT br Continuous variables were described
2022-05-25
Statistical analysis ACCEPTED MANUSCRIPT Continuous variables were described as the mean ± standard deviation (SD) for normally distributed variables or the median for variables with a skewed distribution. Categorical variables were described as percentages. Comparisons among groups were condu
-
br There are a few limitations to this study
2022-05-25
There are a few limitations to this study that should be mentioned. First, the prognostic information of patients with breast cancer with KMT2C mutations is absent for the Chinese cohort. Second, we identi-fied several significant differences between the Chinese, TCGA, and METABRIC cohorts, such a
-
br CTU represents a new lead compound with potential
2022-05-23
CTU represents a new lead compound with potential anti-cancer activity, and a well-defined structure-activity relationship (SAR) is now required for its optimization and development. From our initial series of analogues it appeared that substitution of the ω-terminal aryl system with strong electr
-
br Conclusions br In this study
2022-05-22
5. Conclusions In this study, we constructed the human prostate cancer PC-3-luc Mitoquinol with a stable expression of the luciferase gene and it was have the same biological characteristics as PC-3 cells, so PC-3-luc cells can replace PC-3 cells for in vivo and in vitro experiments. Ad-VT has
-
br The caspases cascade is groups of proteinases that
2022-05-22
The caspases cascade is groups of proteinases that have central roles in the activation of apoptosis. Activation of specific caspase determines the cell death pathways, for instance, activation of caspase-8 indicates the involvement of the extrinsic apoptosis pathway, while activation of caspase-9
-
Yoda1 br Evaluation of the release characteristics of CPT
2022-05-22
Evaluation of the release characteristics of CPT from the DSPE-NLBs bore a strong resemblance to that obtained from the CHO-NLBs in both a physiologic and tumoral pH release medium. This observation was attributed to lower stability of the DSPE-NLBs, due to the less anionic surface charge, as well
-
miR s suppressed the proliferation of J BV BC
2022-05-20
miR-143s suppressed the proliferation of 253J-BV BC cells through the decreased expression of RAS isoform proteins (K-RAS and H-RAS), Erk, and Akt by RNAi. To confirm how Syn-miR-143s affected the expression of RAS iso-form genes in the cells, we examined the expression levels of each RAS isoform
-
br GTATTCA and reverse primer
2022-05-19
GTATTCA-3′ and reverse primer:5′- ATTTGCTAGACCACACTCG TTA-3′), ANGPTL6(forward prrimer:5′- ACAGAGTGGAGTGTA TGAA CTG-3′ and reverse primer:5′- AATAGGAGTCTCGGTC CCTATC -3′), ANGPTL7(forward prrimer:5′- CACTTTGTTTTGGGC AATGAAC-3′ and reverse primer:5′- TTTGAGGGAGTAGGTAGATCCA -3′), ANGPTL8(forward pr
-
br b Center for Innovation Technology and
2022-05-18
b Center for Innovation, Technology and Education–CITE, Universidade Anhembi Morumbi–UAM, Parque Tecnológico de São José dos Campos, Estr. Dr. Altino Bondensan, 500, São José dos Campos, SP, 12247-016, Brazil c Laboratory of Cardiovascular Pathology, Department of Pathology–LIM22, University of
-
Gene nature Very hydrophilic br Medium
2022-05-17
Gene nature Very hydrophilic Medium hydrophilic Slightly hydrophilic 2.2. Realization of electrical network for gene using amino FITC-Dextran string model Amino acids are cascaded with each other to form the gene primary structure, as shown in Fig. 1. Likewise, the n numbers of amino a
-
br Impact of intravenous diluent on the
2022-05-10
3.6. Impact of intravenous diluent on the FNP properties The final products of our study are lyophilized powders of α-man-gostin loaded FNPs for intravenous injection propose. Before injection, the powders need to be reconstituted in intravenous diluent such as dextrose 5% and NSS. Therefore, t
-
br The Cancer Genome Atlas Data
2022-05-07
The Cancer Genome Atlas Data and cBioPortal The Cancer Genome Atlas had both sequencing and pathological data on 30 different cancers.45 The breast invasive carcinoma (The Cancer Genome Atlas, Provisional) dataset, including data from 1,107 cases with pathology reports, was selected for further
-
METHODS br Surveillance Epidemiology and End Results Program Medicare database
2022-05-07
METHODS Surveillance, Epidemiology, and End Results Program-Medicare database The National Cancer Institute’s Surveillance, Epidemi-ology, and End Results (SEER) tumor registry linked to the Medicare database was used for this DETA NONOate study. The SEER-Medicare data link 2 national databas
-
br Available online at www
2022-05-06
Available online at www.sciencedirect.com ScienceDirect Comparison of Laparoscopic and Open Approach in Treating Gallbladder Cancer Changzhou First People’s Hospital, The Third Affiliated Hospital of Soochow University, Changzhou, Jiangsu, China Keywords: Gallbladder cancer Radic
-
br ACCEPTED MANUSCRIPT br Abbreviations Electronic medical record EMR confidence
2022-05-06
ACCEPTED MANUSCRIPT Abbreviations: Electronic medical record (EMR), confidence interval (CI), relative risk (RR) ACCEPTED MANUSCRIPT CAPSULE SUMMARY What is known: The benefit of teledermatology for triaging potential skin cancers is not adequately understood. Knowledge gained: The