-
miR s suppressed the proliferation of J BV BC
2022-05-20
miR-143s suppressed the proliferation of 253J-BV BC cells through the decreased expression of RAS isoform proteins (K-RAS and H-RAS), Erk, and Akt by RNAi. To confirm how Syn-miR-143s affected the expression of RAS iso-form genes in the cells, we examined the expression levels of each RAS isoform
-
br GTATTCA and reverse primer
2022-05-19
GTATTCA-3′ and reverse primer:5′- ATTTGCTAGACCACACTCG TTA-3′), ANGPTL6(forward prrimer:5′- ACAGAGTGGAGTGTA TGAA CTG-3′ and reverse primer:5′- AATAGGAGTCTCGGTC CCTATC -3′), ANGPTL7(forward prrimer:5′- CACTTTGTTTTGGGC AATGAAC-3′ and reverse primer:5′- TTTGAGGGAGTAGGTAGATCCA -3′), ANGPTL8(forward pr
-
br b Center for Innovation Technology and
2022-05-18
b Center for Innovation, Technology and Education–CITE, Universidade Anhembi Morumbi–UAM, Parque Tecnológico de São José dos Campos, Estr. Dr. Altino Bondensan, 500, São José dos Campos, SP, 12247-016, Brazil c Laboratory of Cardiovascular Pathology, Department of Pathology–LIM22, University of
-
Gene nature Very hydrophilic br Medium
2022-05-17
Gene nature Very hydrophilic Medium hydrophilic Slightly hydrophilic 2.2. Realization of electrical network for gene using amino FITC-Dextran string model Amino acids are cascaded with each other to form the gene primary structure, as shown in Fig. 1. Likewise, the n numbers of amino a
-
br Impact of intravenous diluent on the
2022-05-10
3.6. Impact of intravenous diluent on the FNP properties The final products of our study are lyophilized powders of α-man-gostin loaded FNPs for intravenous injection propose. Before injection, the powders need to be reconstituted in intravenous diluent such as dextrose 5% and NSS. Therefore, t
-
br The Cancer Genome Atlas Data
2022-05-07
The Cancer Genome Atlas Data and cBioPortal The Cancer Genome Atlas had both sequencing and pathological data on 30 different cancers.45 The breast invasive carcinoma (The Cancer Genome Atlas, Provisional) dataset, including data from 1,107 cases with pathology reports, was selected for further
-
METHODS br Surveillance Epidemiology and End Results Program Medicare database
2022-05-07
METHODS Surveillance, Epidemiology, and End Results Program-Medicare database The National Cancer Institute’s Surveillance, Epidemi-ology, and End Results (SEER) tumor registry linked to the Medicare database was used for this DETA NONOate study. The SEER-Medicare data link 2 national databas
-
br Available online at www
2022-05-06
Available online at www.sciencedirect.com ScienceDirect Comparison of Laparoscopic and Open Approach in Treating Gallbladder Cancer Changzhou First People’s Hospital, The Third Affiliated Hospital of Soochow University, Changzhou, Jiangsu, China Keywords: Gallbladder cancer Radic
-
br ACCEPTED MANUSCRIPT br Abbreviations Electronic medical record EMR confidence
2022-05-06
ACCEPTED MANUSCRIPT Abbreviations: Electronic medical record (EMR), confidence interval (CI), relative risk (RR) ACCEPTED MANUSCRIPT CAPSULE SUMMARY What is known: The benefit of teledermatology for triaging potential skin cancers is not adequately understood. Knowledge gained: The
-
br Sensitivity test and detection limit br
2022-05-04
3.3. Sensitivity test and detection limit To verify the sensitivity of this method, different concentrations of PCR products amplified from the LNCaP cell line were applied to the system. Color changes of AuNP solutions were observed by the naked eye and then scanned within the NCT-501 spectra
-
br DepArray analysis and next generation sequencing br
2022-05-04
2.3. DepArray analysis and next-generation sequencing In order to determine the existence, frequency and origin of CK+/VIM+ cells in the tumor Talaporfin population, we chose a DepArray method (Silicon Biosystems, Bologna) [20]. Briefly, samples in tubes were sent to Silicon Biosystems, whe
-
br Fig Expression of key cholesterol homeostasis genes in
2022-04-29
Fig. 3. Expression of key cholesterol homeostasis genes in tumor and adjacent normal tissues in local cohort. The Echinomycin of A HMGCR, B SREBF2, C LDLR, D SCARB1, E NR1H3, F NR1H2 and G ABCA1 was investigated using qPCR. Fig. 4. Expression of key cholesterol homeostasis genes in TCGA COAD &
-
Oral Oncology br Appendix A Supplementary material br
2022-04-29
Oral Oncology 89 (2019) 144–149 Appendix A. Supplementary material References [3] Pohar S, Gay H, Rosenbaum P, Klish D, Bogart J, Sagerman R, et al. Malignant parotid tumors: presentation, clinical/pathologic prognostic factors, and treatment outcomes. Int J Rad Oncol Biol Phys 2005;61:1
-
br MM or CSR It has been reported
2022-04-29
MM or CSR. It has been reported rituximab treatment resulted in a significant clinical improvement in LEMS [26]. One patient in our study gained the status of MM-3 after rituximab treatment with QMG score dropping from 18 to 2 in 6 months. In conclusion, patients with SCLC-LEMS tended to take l
-
br of positive stained cells E of SA
2022-04-26
of positive stained cells (E) of SA-β-Gal staining before and after knocking down of SMARCA5 by two shRNAs. *** represents p then influence senescence, we stably knocked down SMARCA5 by lentivirus mediated short hairpin RNA in A549 and U2OS cells, and reduced BAZ1A protein levels were found in S