Archives

  • 2022-08
  • 2022-07
  • 2022-05
  • 2022-04
  • 2021-03
  • 2020-08
  • 2020-07
  • 2018-07
  • br GTATTCA and reverse primer

    2022-05-19


    GTATTCA-3′ and reverse primer:5′- ATTTGCTAGACCACACTCG TTA-3′), ANGPTL6(forward prrimer:5′- ACAGAGTGGAGTGTA TGAA CTG-3′ and reverse primer:5′- AATAGGAGTCTCGGTC CCTATC -3′), ANGPTL7(forward prrimer:5′- CACTTTGTTTTGGGC AATGAAC-3′ and reverse primer:5′- TTTGAGGGAGTAGGTAGATCCA -3′), ANGPTL8(forward prrimer:5′- ATGGAGGAGG
    ATATTCTGCAG-3′ and reverse primer:5′- AAGACCTCAAATTCTCG GTAGG -3′), and universal probe the glyceraldehyde-3-phosphate de-hydrogenase (GAPDH) (forward prrimer 5′-AGCCACATCGC TCAGACAC-3′ and reverse primer 5′-GCCCAATACGACCAAA TCC-3′)
    2.4. Transfection with shRNA plasmid
    The following shRNA and vector controls were purchased from Shanghai GeneChem Co. Transfection was performed using Lipofectamine 200 according to the manufacturer’s instructions. ANGPLT6 shRNA (shANGPTL6) and the control shRNA (Ctrl) vectors were transfected into GCIY cells. After transfection, the VH-298 were cultured in culture medium containing 3 mg/ml puromycin (Invitrogen, USA).
    2.5. In vitro HUVEC tube formation assay
    When the cells grew to 80% confluence, they were starved for 24 h (serum-free culture). After thawing at 4 °C overnight, 10 u l of Matrigel (growth factor reduced, BD Biosciences, USA) was precoated onto a u-Slide Angiogenesis (ibidi, USA) and then incubated at 37 °C for at least 2 h to conform Matrigel solidification. HUVECs at a density of 2 × 105 cells/ml in different culture conditions were seeded onto each u-slide. After incubation at 37 °C for 5 h, networks images were taken under an inverted microscope.
    2.6. HUVEC proliferation assay
    HUVECs during the logarithmic growth period were used for a proliferation assay. Then, 100 ul (2 × 103/well) cells were added to a 96-well plate and replenished in the conditioned medium after 24 h. Cell growth was calculated using a Cell Counting Kit-8 (CCK8) (Dojiindo, Kumamoto, Japan), according to the protocol provided by the manufacturer. The HUVECs were stained with 10 μl CCK8 for 2 h at 37 °C in a CO2 incubator for 24 h, 48 h, and 72 h, respectively. The spectrophotometric absorbance values at 450 nm (OD value) were measured by a microplate reader. All assays were performed in tripli-cate.
    2.7. Migration and invasion assays
    Migration and invasion assays were assessed using chambers with a size diameter of with 8 microns (Corning, USA). The upper chambers were separately inculated with 1 × 10 4 each type of cell. Then, the different conditioned media were added to the lower chamber. For the invasion experiment, the inner surface of the membrane was precoated with 100 μl of 1 mg/ml Matrigel (BD, USA) to form an artificial
    Fig. 1. ANGPTL6 is overexpressed in AFP-producing gastric cancer cell lines. (A) The RNA expression of ANGPTL1-8 in six gastric cancer cell lines (GCIY, FU97, MKN1, SGC-7901, MGC-803, AGS). (B) The protein level of ANGPTL6 in AFPGC is much higher than that in common gastric cancer. The data are expressed as the mean ± standard deviation (SD) and are representative of three independent experiments. *P < 0.05; **P < 0.01 compared with control.
    basement. After 24 h incubation and fixation with formaldehyde, the cells that did not migrate through the holes and removed by cotton swabs. Subsequently, the cells inside the filter membrane were sub-jected to 0.1% crystal violet for 20 min. The cells that penetrated the lower membrane were enumerated. Cells in five random fields re-present as the average number of cells/field of each membrane. In each case, triplicate independent experiments were conducted for each group.
    2.8. Cell apoptosis assay
    An Annexin V-FITC/PI Apoptosis Kit (BD Biosciences, San Jose, CA, USA) was used to investigate cell apoptosis. Briefly, a total of 1 × 105 cells were harvested for 24 h, washed using PBS and resuspended in 100 μl binding buffer at room temperature. Annexin V-FITC (5 μl) was then added and the cell sample was incubated in the dark for 5 min before incubation for another 15 min in the dark with 5 μl PI. The fluorescence intensity analysis was calculated by flow cytometry (FACS Calibur, BD Biosciences). Details are subject to the manufacturer’s in-structions.