-
br From a protein array screen we
2022-07-25
From a protein array screen, we observed that the compounds interfered with the protein expression levels of CapG, ErbB2, FGF-basic, FOXC2, HIF-1a, Tenascin C and CD31/PECAM-1 all of which are involved in several aspects of tumor malignancy and their in-dividual or collective overexpression correl
-
br Statistical analysis br Data are presented
2022-07-25
4.11. Statistical analysis Data are presented as mean ± standard deviation. SPSS 16.0 (SPSS, Chicago, IL) software was applied to perform statistical analysis. Competing interests The authors declare that they have no competing interests. Acknowledgements This research was supported
-
br Assessment of the IRE and PERK eIF branches
2022-07-25
Assessment of the IRE1α and PERK/eIF2α branches of the UPR AGS Mitomycin C were plated at 1.5 × 104 cells/well and incubated with the benzoquinones under study for 8 h in the presence or absence of 4μ8C (5 µm) or salubrinal (40 µm), IRE1α and PERK reference in-hibitors respectively. The effects
-
br Autophagy removes oncogenic proteins and maintains genomic stability br
2022-07-06
3.1.1. Autophagy removes oncogenic proteins and maintains genomic stability p53 is activated in response to a variety of stress conditions, in-cluding DNA damage, oxidative stress, replicative stress, genomic in-stability etc. (Meek, 2015). In cancer cells, the proteasomal degradation of the mu
-
Statistical analysis br ACCEPTED MANUSCRIPT br Continuous variables were described
2022-05-25
Statistical analysis ACCEPTED MANUSCRIPT Continuous variables were described as the mean ± standard deviation (SD) for normally distributed variables or the median for variables with a skewed distribution. Categorical variables were described as percentages. Comparisons among groups were condu
-
br There are a few limitations to this study
2022-05-25
There are a few limitations to this study that should be mentioned. First, the prognostic information of patients with breast cancer with KMT2C mutations is absent for the Chinese cohort. Second, we identi-fied several significant differences between the Chinese, TCGA, and METABRIC cohorts, such a
-
br CTU represents a new lead compound with potential
2022-05-23
CTU represents a new lead compound with potential anti-cancer activity, and a well-defined structure-activity relationship (SAR) is now required for its optimization and development. From our initial series of analogues it appeared that substitution of the ω-terminal aryl system with strong electr
-
br Conclusions br In this study
2022-05-22
5. Conclusions In this study, we constructed the human prostate cancer PC-3-luc Mitoquinol with a stable expression of the luciferase gene and it was have the same biological characteristics as PC-3 cells, so PC-3-luc cells can replace PC-3 cells for in vivo and in vitro experiments. Ad-VT has
-
br The caspases cascade is groups of proteinases that
2022-05-22
The caspases cascade is groups of proteinases that have central roles in the activation of apoptosis. Activation of specific caspase determines the cell death pathways, for instance, activation of caspase-8 indicates the involvement of the extrinsic apoptosis pathway, while activation of caspase-9
-
Yoda1 br Evaluation of the release characteristics of CPT
2022-05-22
Evaluation of the release characteristics of CPT from the DSPE-NLBs bore a strong resemblance to that obtained from the CHO-NLBs in both a physiologic and tumoral pH release medium. This observation was attributed to lower stability of the DSPE-NLBs, due to the less anionic surface charge, as well
-
miR s suppressed the proliferation of J BV BC
2022-05-20
miR-143s suppressed the proliferation of 253J-BV BC cells through the decreased expression of RAS isoform proteins (K-RAS and H-RAS), Erk, and Akt by RNAi. To confirm how Syn-miR-143s affected the expression of RAS iso-form genes in the cells, we examined the expression levels of each RAS isoform
-
br GTATTCA and reverse primer
2022-05-19
GTATTCA-3′ and reverse primer:5′- ATTTGCTAGACCACACTCG TTA-3′), ANGPTL6(forward prrimer:5′- ACAGAGTGGAGTGTA TGAA CTG-3′ and reverse primer:5′- AATAGGAGTCTCGGTC CCTATC -3′), ANGPTL7(forward prrimer:5′- CACTTTGTTTTGGGC AATGAAC-3′ and reverse primer:5′- TTTGAGGGAGTAGGTAGATCCA -3′), ANGPTL8(forward pr
-
br b Center for Innovation Technology and
2022-05-18
b Center for Innovation, Technology and Education–CITE, Universidade Anhembi Morumbi–UAM, Parque Tecnológico de São José dos Campos, Estr. Dr. Altino Bondensan, 500, São José dos Campos, SP, 12247-016, Brazil c Laboratory of Cardiovascular Pathology, Department of Pathology–LIM22, University of
-
Gene nature Very hydrophilic br Medium
2022-05-17
Gene nature Very hydrophilic Medium hydrophilic Slightly hydrophilic 2.2. Realization of electrical network for gene using amino FITC-Dextran string model Amino acids are cascaded with each other to form the gene primary structure, as shown in Fig. 1. Likewise, the n numbers of amino a
-
br Impact of intravenous diluent on the
2022-05-10
3.6. Impact of intravenous diluent on the FNP properties The final products of our study are lyophilized powders of α-man-gostin loaded FNPs for intravenous injection propose. Before injection, the powders need to be reconstituted in intravenous diluent such as dextrose 5% and NSS. Therefore, t
130 records 4/9 page Previous Next 12345 Next 5 pages Last page